Implementation of a Teleconsultation Protocol in a Hospital Emergency Department

October 1, 2020 0 Comments

Mechanical Nociception in Mice and Rats: Measurement with Automated von Frey Gear

von Frey hairs are vital instruments for the examine of mechanisms of cutaneous stimulation-induced sensory enter. Mechanical power is exerted through software of a selected hair to the cutaneous receptive subject till buckling of the hair happens.

Probably the most generally used von Frey filaments are productive in evaluating behavioral responses of neuropathic ache in preclinical and scientific analysis. To scale back the potential experimenter bias, automated devices are being developed for behavioral evaluation.


Rabbit Polyclonal antibody Anti-CRBN
Anti-CRBN 50 µg
EUR 349
anti- MIP-3-beta antibody
FNab05194 100µg
EUR 505.25
  • Immunogen: chemokine(C-C motif) ligand 19
  • Uniprot ID: Q99731
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against MIP-3-beta
Anti-MIP-3 alpha Antibody
A00748 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MIP-3 alpha Antibody (CCL20) detection.tested for IHC in Human, Mouse.
Anti-MIP-3-beta antibody
PAab05194 100 ug
EUR 355
EF016652 96 Tests
EUR 689
EF016984 96 Tests
EUR 689
EF017888 96 Tests
EUR 689
EF012726 96 Tests
EUR 689
EF013760 96 Tests
EUR 689
EF013761 96 Tests
EUR 689
EF010865 96 Tests
EUR 689
PAab09791 100 ug
EUR 386
anti- MIP antibody
FNab05193 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:1000
  • IHC: 1:100 - 1:200
  • Immunogen: major intrinsic protein of lens fiber
  • Uniprot ID: P30301
  • Gene ID: 4284
  • Research Area: Neuroscience
Description: Antibody raised against MIP
Anti-MIP antibody
PAab05193 100 ug
EUR 386
Anti-MIP antibody
STJ24556 100 µl
EUR 277
Description: Major intrinsic protein is a member of the water-transporting aquaporins as well as the original member of the MIP family of channel proteins. The function of the fiber cell membrane protein encoded by this gene is undetermined, yet this protein is speculated to play a role in intracellular communication. The MIP protein is expressed in the ocular lens and is required for correct lens function. This gene has been mapped among aquaporins AQP2, AQP5, and AQP6, in a potential gene cluster at 12q13.
Anti-MIP-3 Alpha/CCL20 Antibody
A00748-2 100ug/vial
EUR 294
MIP-3, CCL23, human
RC315-34 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
Rabbit Anti Human Mip-3 Alpha Polyclonal Antibody
CPBT-65216RH 0.1 mg
EUR 881
Rabbit Anti Human Mip-3 Beta Polyclonal Antibody
CPBT-65218RH 0.1 mg
EUR 881
anti- MIP-3α antibody
FNab09791 100µg
EUR 548.75
  • Recommended dilution: IHC: 1:50-1:500
  • Immunogen: chemokine(C-C motif) ligand 20
  • Uniprot ID: P78556
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against MIP-3α
Anti-MIP-5 Antibody
A05563 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MIP-5 Antibody (CCL15) detection.tested for IHC in Human.
Anti-MIP-1b Antibody
A16621 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for MIP-1b Antibody (CCL4L1) detection. Tested with WB in Human.
Anti-MIP- alpha antibody
STJ94130 200 µl
EUR 197
Description: Rabbit polyclonal to MIP-1alpha.
Anti-MIP- beta antibody
STJ94131 200 µl
EUR 197
Description: Rabbit polyclonal to MIP-3beta.
Anti-MIP-T3 antibody
STJ94133 200 µl
EUR 197
Description: Rabbit polyclonal to MIP-T3.
Anti-MIP-1b antibody
STJ97347 200 µl
EUR 197
Description: Rabbit polyclonal to MIP-1b.
Anti-MIP- alpha antibody
STJ98775 200 µl
EUR 197
Description: Rabbit polyclonal to MIP-3alpha.
Anti-MIP-5 antibody
STJ98780 200 µl
EUR 197
Description: Rabbit polyclonal to MIP-5.
Anti-MIP- beta antibody
STJ96572 200 µl
EUR 197
Description: Rabbit polyclonal to MIP-1beta.
Anti-MIP-3 alpha Antibody Biotin Conjugated
B00748-1 100ug
EUR 432
Description: Rabbit Polyclonal MIP-3 alpha Antibody Biotin Conjugated. Validated in WB and tested in Human.
Anti-VEGF Receptor 3/FLT4 Antibody
A01276-3 100ug/vial
EUR 334
Anti-14-3-3 alpha + beta Rabbit Monoclonal Antibody
M02431-3 100ug/vial
EUR 397
Description: Rabbit Monoclonal 14-3-3 alpha + beta Antibody. Validated in Flow Cytometry, IP, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.
MIP-3-alpha/CCL20, Human
HY-P7262 10ug
EUR 268
MIP-3/CCL23, human recombinant
EUR 207
MIP-3/CCL23, human recombinant
EUR 675
MIP-3 alpha, CCL20, human
RC315-31 5ug
EUR 104.38
  • Product category: Proteins/Recombinant Proteins/Cytokines
Rabbit Anti Human Mip-3 Beta Polyclonal Antibody,Biotin
CPBT-65217RH 50 µg
EUR 881
Anti-Human Ki67 Antibody
M00254-3 100ul
EUR 397
Description: Rabbit Polyclonal Human Ki67 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.
Anti-Human IBA1 Antibody
M01394-3 100ul
EUR 397
Description: Chicken Polyclonal Human IBA1 Antibody. Validated in IF, IHC, WB and tested in Human.
Anti-active Caspase-3 Rabbit Monoclonal Antibody
M00334-3 100ug/vial
EUR 397
Description: Anti-active Caspase-3 Rabbit Monoclonal Antibody tested for IF, IHC, ICC, WB in Human
Anti-Galectin 3/LGALS3 Antibody (monoclonal, 12B12)
M00621-3 100ug/vial
EUR 334
Polyclonal Goat anti-GST α-form
GST-ANTI-1 50 uL
EUR 280
Polyclonal Goat anti-GST μ-form
GST-ANTI-2 50 uL
EUR 280
Anti-Glyceraldehyde 3-Phosphate Dehydrogenase [GAPDH] Monoclonal Antibody
M00227-3 100ul
EUR 397
Description: Mouse Monoclonal Glyceraldehyde 3-Phosphate Dehydrogenase [GAPDH] Antibody. Validated in IHC, WB and tested in Equine.
Anti-MIP-1 alpha Antibody
A00405 100ug
EUR 432
Description: Rabbit Polyclonal MIP-1 alpha Antibody. Validated in WB and tested in Mouse.
Anti-Aquaporin 0/MIP Antibody
PB9811 100ug/vial
EUR 294
Anti-Aquaporin 0/MIP Antibody
PA2110 100ug/vial
EUR 294
Anti-CXCL2 / MIP-2 antibody
STJ71916 100 µg
EUR 359
Anti-CCL19/Mip 3 Beta Rabbit Monoclonal Antibody
M01605 100ug/vial
EUR 397
Description: Rabbit Monoclonal CCL19/Mip 3 Beta Antibody. Validated in WB and tested in Human.
rHu MIP-3-beta
AK8232-0005 5µg Ask for price
rHu MIP-3-beta
AK8232-0020 20µg Ask for price
rHu MIP-3-beta
AK8232-0100 100µg Ask for price
rHu MIP-3-beta
AK8232-1000 1mg Ask for price
rHu MIP-3-alpha
AK8271-0005 5µg Ask for price
rHu MIP-3-alpha
AK8271-0020 20µg Ask for price
rHu MIP-3-alpha
AK8271-0100 100µg Ask for price
rHu MIP-3-alpha
AK8271-1000 1mg Ask for price
MIP-3? Polyclonal Antibody
ES7130-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MIP-3? from Human. This antibody is tested and validated for IHC, WB, ELISA
MIP-3? Polyclonal Antibody
ES7130-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MIP-3? from Human. This antibody is tested and validated for IHC, WB, ELISA
MIP-3? Polyclonal Antibody
ES8712-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against MIP-3? from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA
MIP-3? Polyclonal Antibody
ES8712-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against MIP-3? from Human/Mouse. This antibody is tested and validated for IHC, WB, ELISA
MIP-3-beta Antibody
abx235194-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.
MIP-3/CCL23 (CHO-expressed), Human
HY-P7259 10ug
EUR 268
Recombinant Human MIP-3 (CCL23) Protein
PROTP55773-1 20ug
EUR 317
Description: MIP-3 is a CC chemokine that signals through the CCR1 receptor. MIP-3 chemoattracts monocytes, resting T-lymphocytes and neutrophils, but does not chemoattract activated lymphocytes. Additionally, MIP-3 has been shown to inhibit colony formation of bone marrow myeloid immature progenitors. Recombinant human MIP-3 is an 11.3 kDa protein containing 99 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.
Mip/ Rat Mip ELISA Kit
ELI-23038r 96 Tests
EUR 886
Anti-MRP1 (human) Monoclonal Antibody (QCRL-1)
M00872-3 1ml
EUR 675
Description: Mouse Monoclonal MRP1 (human) Antibody (QCRL-1). Validated in IP, IF and tested in Human.
Anti-Human IgM Rabbit Monoclonal Antibody, Clone#RM121
M07469-3 100ug
EUR 375
Description: Anti-Human IgM Rabbit Monoclonal Antibody, Clone#RM121 tested in ICC, IHC, FC, ELISA, reactive to Human
Goat Anti Human Mip-1 Alpha Polyclonal Antibody
CPBT-65207GH 0.1 mg
EUR 881
Rabbit Anti Human Mip-1 Beta Polyclonal Antibody
CPBT-65212RH 0.1 mg
EUR 881
Anti-Nanog Antibody
A00153-3 100ug/vial
EUR 294
Anti-IL17C Antibody
A00164-3 100ug/vial
EUR 294
Anti-AICDA Antibody
A00267-3 100ug/vial
EUR 294
Anti-ICOS Antibody
A00291-3 100ug/vial
EUR 334
Anti-TLR1 Antibody
A00429-3 100ug/vial
EUR 334
Anti-IGFBP3 Antibody
A00435-3 100ug/vial
EUR 294
Anti-TANK Antibody
A00445-3 100ug/vial
EUR 334
Anti-FGF23 Antibody
A00478-3 100ug/vial
EUR 294
Anti-Leptin Antibody
A00479-3 100ug/vial
EUR 294
Anti-CD5 Antibody
A00480-3 100ug/vial
EUR 334
Anti-SYK Antibody
A00490-3 100ug/vial
EUR 294
Anti-PON1 Antibody
A00516-3 100ug/vial
EUR 334
Anti-CSF1 Antibody
A00620-3 100ug/vial
EUR 294
Anti-LBP Antibody
A00809-3 100ug/vial
EUR 294
Anti-IL22 Antibody
A00963-3 100ug/vial
EUR 294
Anti-MBL2 Antibody
A01000-3 100ug/vial
EUR 294
Anti-KCNH1 Antibody
A01036-3 100ug/vial
EUR 294
Anti-IL12B Antibody
A01152-3 100ug/vial
EUR 334
Anti-PRMT1 Antibody
A01417-3 100ug/vial
EUR 294
Anti-TFF3 Antibody
A01738-3 100ug/vial
EUR 334
Anti-IFNAR2 Antibody
A02056-3 100ug/vial
EUR 334
Anti-IL17F Antibody
A02062-3 100ug/vial
EUR 294
Anti-TREM1 Antibody
A02135-3 100ug/vial
EUR 294
Anti-SENP1 Antibody
A02156-3 100ug/vial
EUR 294
Anti-BTC Antibody
A02171-3 100ug/vial
EUR 334
Anti-EEA1 Antibody
A02296-3 100ug/vial
EUR 294
Anti-JAK3 Antibody
A02598-3 100ug/vial
EUR 294
Anti-APRT Antibody
A02721-3 100ug/vial
EUR 334
Anti-CUL2 Antibody
A02986-3 100ug/vial
EUR 334
Anti-EIF4A1 Antibody
A03922-3 100ug/vial
EUR 334
Anti-SLIT1 Antibody
A04113-3 100ug/vial
EUR 294

Telemedicine in Instances of the Pandemic Produced by COVID-19: Implementation of a Teleconsultation Protocol in a Hospital Emergency Division


Because the first case of COVID-19 was reported in Spain, nearly 22% of healthcare professionals have been contaminated. Among the many principal causes are publicity throughout the care of suspected sufferers and asymptomatic sufferers, which precipitated a better lack of safety in some instances, and to the worldwide scarcity of non-public protecting gear as a result of sturdy demand for it.

The primary goal of this examine was to judge the effectiveness of a teleconsultation protocol with sufferers who had respiratory signs within the discount of the consumption of non-public protecting gear (PPE) in a hospital emergency service (HES) throughout the COVID-19 pandemic.

It is a descriptive and retrospective examine that analyzes the implementation of a teleconsultation protocol with sufferers with respiratory issues handled within the HES on the Hospital de Poniente (Almeria), between 18 March and 30 April 2020.

Within the chosen examine interval, 5353 sufferers had been handled within the HES of the Hospital de Poniente; of those, 15.43% confirmed respiratory signs and had been referred to the Respiratory Circuit, of which 42.2% did so through teleconsultation. Sixty-six instances of COVID-19 had been recognized, 57.6% had been male, and the median age was 71 years outdated. The primary illness associated was pneumonia (89.4%), signs extra frequent had been cough (77.3%), fever (77.3%), and dyspnea (60.6%).

Lastly, 56.1% of the sufferers that attended had one or extra comorbidities, hypertension (53%), and diabetes (36.4%), which grew to become the primary danger components. The outcomes confirmed that the implementation of teleconsultation within the HES decreased the potential of an infection and allowed for a extra environment friendly consumption of non-public protecting gear.

Exertional Warmth Sickness Preparedness Methods: Environmental Monitoring Insurance policies in United States Excessive Faculties

Background and targets: Environmental monitoring permits for an evaluation of the ambient circumstances affecting a bodily energetic individual’s potential to thermoregulate and can be utilized to evaluate exertional warmth sickness danger. Utilizing public well being fashions such because the precaution adoption course of mannequin (PAPM) will help determine particular person’s readiness to behave to undertake environmental monitoring insurance policies for the security of highschool athletes. The aim of this examine was to analyze the adoption of insurance policies and procedures used for monitoring and modifying exercise within the warmth in United States (US) excessive faculties. Supplies and

Strategies: Utilizing a cross-sectional design, we distributed a web based questionnaire to athletic trainers (ATs) working in excessive faculties within the US. The questionnaire was developed based mostly on finest apply requirements associated to environmental monitoring and modification of exercise within the warmth as outlined within the 2015 Nationwide Athletic Trainers’ Affiliation Place Assertion: Exertional Warmth Sickness. The PAPM was used to border questions because it permits for the identification of ATs’ readiness to behave. PAPM contains eight phases: unaware of the necessity for the coverage, unaware if the varsity has this coverage, unengaged, undecided, determined to not act, determined to behave, appearing, and sustaining. Invites had been despatched through electronic mail and social media and resulted in 529 full responses. Knowledge had been aggregated and introduced as proportions.

Outcomes: Total, 161 (161/529, 30.4%) ATs report they don’t have a written coverage and process for the prevention and administration of exertional warmth stroke. The coverage element with the best adoption was modifying the usage of protecting gear (appearing = 8.2%, sustaining = 77.5%). As well as, 28% of ATs report adoption of all seven elements for a complete environmental monitoring coverage.

Conclusions: These findings point out an absence of adoption of environmental monitoring insurance policies in US excessive faculties. Secondarily, the PAPM, facilitators and obstacles information spotlight areas to focus future efforts to boost adoption.

anti- HMGB1 antibody

FNab03924 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: high-mobility group box 1
  • Uniprot ID: P09429
  • Gene ID: 3146
  • Research Area: Neuroscience, Signal Transduction, Metabolism, Epigenetics
Description: Antibody raised against HMGB1

Anti-HMGB1 Antibody

A00066-1 100ug/vial
EUR 334

Anti-HMGB1 antibody

PAab03924 100 ug
EUR 355

Anti-HMGB1 Antibody

STJ501358 100 µg
EUR 476

Anti-HMGB1 antibody

STJ29816 100 µl
EUR 457
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 antibody

STJ24037 100 µl
EUR 277
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 antibody

STJ24039 100 µl
EUR 413
Description: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.

Anti-HMGB1 (1B2)

YF-MA13482 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D10)

YF-MA13483 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D9)

YF-MA13484 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1D5)

YF-MA10425 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (1B11)

YF-MA10426 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-HMGB1 (2F6)

YF-MA10427 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349

HMGB1, human

RC712-17 50ug
EUR 169.63
  • Product category: Proteins/Recombinant Proteins/Other

Anti-HMGB1 Antibody (Biotin)

STJ501359 100 µg
EUR 586

Anti-HMGB1 Antibody (FITC)

STJ501360 100 µg
EUR 586

Anti-HMGB1 (1E6-E10)

YF-MA10424 100 ug
EUR 363
Description: Mouse monoclonal to HMGB1

Anti-Bovine HMGB1 IgG Antibodies

7028 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 IgG Antibodies

Anti-Bovine HMGB1 IgY Antibodies

7064 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 IgY Antibodies

Anti-HMGB1 Antibody (monoclonal, 5H3)

M00066-2 100ug/vial
EUR 334

Anti-HMGB1 (KO Validated) Antibody

A2127-100 100 µl
EUR 399

Recombinant Human HMGB1

P0194 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P09429
Description: Recombinant Human protein for HMGB1

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Anti-HMGB1 Peptide (2-11) Antibodies

7029 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-HMGB1 Peptide (2-11) Antibodies

Anti-HMGB1 Peptide (166-176) Antibodies

7030 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-HMGB1 Peptide (166-176) Antibodies

HMGB1 Antibody

AF7020 200ul
EUR 376
Description: HMGB1 antibody detects endogenous levels of total HMGB1.

HMGB1 Protein

  • EUR 1887.00
  • EUR 1261.00
  • EUR 1372.00
  • EUR 968.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1-2 months.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HMGB1 antibody

ABF7020 100 ug
EUR 438

HMGB1 Protein

  • EUR 230.00
  • EUR 2332.00
  • EUR 328.00
  • 10 ug
  • 1 mg
  • 50 ug
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Bovine HMGB1

9050 1 mg/ml x 0.1 ml
EUR 309.55
Description: Bovine HMGB1

HMGB1 Antibody

EUR 452

HMGB1 antibody

70R-31573 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 Antibody

ABD3077 100 ug
EUR 438

HMGB1 Antibody

ABD7008 100 ug
EUR 438

HMGB1 antibody

38424-100ul 100ul
EUR 252

HMGB1 Antibody

33661-100ul 100ul
EUR 252

HMGB1 Antibody

33661-50ul 50ul
EUR 187

HMGB1 Antibody

48606-100ul 100ul
EUR 333

HMGB1 Antibody

48606-50ul 50ul
EUR 239

HMGB1 antibody

10R-1114 100 ul
EUR 349
Description: Mouse monoclonal HMGB1 antibody

HMGB1 protein

30R-1150 100 ug
EUR 457
Description: Purified recombinant Human HMGB1 protein

HMGB1 antibody

70R-17757 50 ul
EUR 435
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 antibody

70R-15458 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody

HMGB1 Antibody

DF7008 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:10-1:50

HMGB1 Antibody

DF3077 200ul
EUR 304
Description: HMGB1 Antibody detects endogenous levels of total HMGB1.

HMGB1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

HMGB1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

HMGB1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HMGB1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

HMGB1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

HMGB1 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

CSB-PA049959-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

HMGB1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HMGB1. Recognizes HMGB1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

HMGB1 Plasmid

PVT7114 2 ug
EUR 266


PVT10093 2 ug
EUR 266


ELA-E0399h 96 Tests
EUR 824


EHH0016 96Tests
EUR 521


EF000598 96 Tests
EUR 689

Human HMGB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Human HMGB1 Protein

RP00010 5 μg
EUR 136

HMGB1 Recombinant Protein (Human)

RP014974 100 ug Ask for price

HMGB1 Recombinant Protein (Human)

RP014977 100 ug Ask for price

Antibody for Human HMGB1

SPC-1259D 0.1ml
EUR 314
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is unconjugated.

Antibody for Human HMGB1

SPC-1259D-A390 0.1ml
EUR 361
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 390.

Antibody for Human HMGB1

SPC-1259D-A488 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 488.

Antibody for Human HMGB1

SPC-1259D-A565 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 565.

Antibody for Human HMGB1

SPC-1259D-A594 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 594.

Antibody for Human HMGB1

SPC-1259D-A633 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 633.

Antibody for Human HMGB1

SPC-1259D-A655 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 655.

Antibody for Human HMGB1

SPC-1259D-A680 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 680.

Antibody for Human HMGB1

SPC-1259D-A700 0.1ml
EUR 360
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to ATTO 700.

Antibody for Human HMGB1

SPC-1259D-ALP 0.1ml
EUR 355
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human HMGB1

SPC-1259D-APC 0.1ml
EUR 359
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to APC .

Antibody for Human HMGB1

SPC-1259D-APCCY7 0.1ml
EUR 432
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to APC/Cy7.

Antibody for Human HMGB1

SPC-1259D-BI 0.1ml
EUR 357
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Biotin.

Antibody for Human HMGB1

SPC-1259D-DY350 0.1ml
EUR 436
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 350.

Antibody for Human HMGB1

SPC-1259D-DY405 0.1ml
EUR 412
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 405.

Antibody for Human HMGB1

SPC-1259D-DY488 0.1ml
EUR 393
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 488.

Antibody for Human HMGB1

SPC-1259D-DY594 0.1ml
EUR 397
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 594.

Antibody for Human HMGB1

SPC-1259D-DY633 0.1ml
EUR 387
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Dylight 633.

Antibody for Human HMGB1

SPC-1259D-FITC 0.1ml
EUR 353
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to FITC.

Antibody for Human HMGB1

SPC-1259D-HRP 0.1ml
EUR 349
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to HRP.

Antibody for Human HMGB1

SPC-1259D-P594 0.1ml
EUR 367
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to PE/ATTO 594.

Antibody for Human HMGB1

SPC-1259D-PCP 0.1ml
EUR 359
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to PerCP.

Antibody for Human HMGB1

SPC-1259D-RPE 0.1ml
EUR 358
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to RPE .

Antibody for Human HMGB1

SPC-1259D-STR 0.1ml
EUR 359
  • HMGB1, also known as high mobility group box 1 protein, and functions much like histones as they are important chromatin proteins. In the nucleus, HMGB1 interacts with nucleosomes, transcription factors and histones. The presence of HMGB1 in the nucl
  • Show more
Description: A polyclonal antibody for HMGB1 from Human | Mouse | Rat. The antibody is produced in rabbit after immunization with Human Synthesized peptide derived from internal of human HMGB1.. The Antibody is tested and validated for WB, ELISA assays with the following recommended dilutions: WB (1:1000), ELISA (1:20000). This HMGB1 antibody is conjugated to Streptavidin.


STJ150454 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HMGB-1 in human serum, plasma and other biological fluids

Anti-Bovine HMGB1 Antibody, Clone 1-37.10FH

7047 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 Antibody

Anti-HMGB1/Hmg 1 Rabbit Monoclonal Antibody

M00066-1 100ug/vial
EUR 397
Description: Rabbit Monoclonal HMGB1/Hmg 1 Antibody. Validated in Flow Cytometry, IF, IHC, ICC, WB and tested in Human, Mouse, Rat.

HMGB1 Blocking Peptide

AF7020-BP 1mg
EUR 195

HMGB1 Conjugated Antibody

C48606 100ul
EUR 397

HMGB1 Conjugated Antibody

C33661 100ul
EUR 397

HMGB1 cloning plasmid

CSB-CL010553HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.

HMGB1 cloning plasmid

CSB-CL010553HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcaaaggagatcctaagaagccgagaggcaaaatgtcatcatatgcattttttgtgcaaacttgtcgggaggagcataagaagaagcacccagatgcttcagtcaacttctcagagttttctaagaagtgctcagagaggtggaagaccatgtctgctaaagagaaaggaaa
  • Show more
Description: A cloning plasmid for the HMGB1 gene.


E21-357 10ug
EUR 343

HMGB1 (AcK12) Antibody

  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1 Blocking Peptide

  • EUR 258.00
  • EUR 384.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1 Polyclonal Antibody

A-2700 100 µl
EUR 724.25
Description: The best epigenetics products

HMGB1 Rabbit pAb

A0718-100ul 100 ul
EUR 308

HMGB1 Rabbit pAb

A0718-200ul 200 ul
EUR 459

HMGB1 Rabbit pAb

A0718-20ul 20 ul Ask for price

HMGB1 Rabbit pAb

A0718-50ul 50 ul Ask for price

HMGB1 Polyclonal Antibody

A51497 100 µg
EUR 570.55
Description: kits suitable for this type of research

HMGB1 protein (Mouse)

30R-2278 100 ug
EUR 2012
Description: Purified recombinant Mouse HMGB1 protein

HMGB1 antibody (HRP)

60R-2188 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (HRP)

HMGB1 antibody (FITC)

60R-2189 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (FITC)

HMGB1 antibody (biotin)

60R-2190 100 ug
EUR 327
Description: Rabbit polyclonal HMGB1 antibody (biotin)

HMGB1 Detection Kit

6010 1 kit
EUR 753.25
Description: HMGB1 Detection Kit

HMGB1 Blocking Peptide

DF7008-BP 1mg
EUR 195


DEIA6297V2 96T
EUR 876
Description: CD provides a capture ELISA kit to determine HMGB1 levels in cell culture medium and sera. This kit contains enough reagents to measure 40 samples in duplicate together with standards.

HMGB1 Blocking Peptide

DF3077-BP 1mg
EUR 195


PVT18174 2 ug
EUR 231

pET28a-HMGB1 Plasmid

PVTB00031-1a 2 ug
EUR 356

pcDNA3.1(+)-HMGB1 Plasmid

PVTB50051-2a 2 ug
EUR 356

pShuttle- CMV- HMGB1

PVT10158 2 ug
EUR 301

HMGB1 ORF Vector (Human) (pORF)

ORF004992 1.0 ug DNA
EUR 95

HMGB1 ORF Vector (Human) (pORF)

ORF004993 1.0 ug DNA
EUR 95

HMGB1 ELISA Kit (Human) (OKAN06342)

OKAN06342 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

HMGB1 ELISA Kit (Human) (OKAN06343)

OKAN06343 96 Wells
EUR 792
Description: Description of target: This gene encodes a protein that belongs to the High Mobility Group-box superfamily. The encoded non-histone, nuclear DNA-binding protein regulates transcription, and is involved in organization of DNA. This protein plays a role in several cellular processes, including inflammation, cell differentiation and tumor cell migration. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants that encode the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 22.5 pg/mL

HMGB1 ELISA Kit (Human) (OKCD04074)

OKCD04074 96 Wells
EUR 753
Description: Description of target: Multifunctional redox sensitive protein with various roles in different cellular compartments. In the nucleus is one of the major chromatin-associated non-histone proteins and acts as a DNA chaperone involved in replication, transcription, chromatin remodeling, V(D)J recombination, DNA repair and genome stability. Proposed to be an universal biosensor for nucleic acids. Promotes host inflammatory response to sterile and infectious signals and is involved in the coordination and integration of innate and adaptive immune responses. In the cytoplasm functions as sensor and/or chaperone for immunogenic nucleic acids implicating the activation of TLR9-mediated immune responses, and mediates autophagy. Acts as danger associated molecular pattern (DAMP) molecule that amplifies immune responses during tissue injury. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28.3 pg/mL

Human CellExp? HMGB1 /HMG1, human recombinant

EUR 229

Human CellExp? HMGB1 /HMG1, human recombinant

EUR 582

Rabbit Anti-HMGB1 monoclonal antibody, clone TB40-14

CABT-L566 100 ul
EUR 777

Anti-Bovine HMGB1 Antibody, Clone 1-37.10FH, Biotinylated

70471 1 mg/ml x 0.1 ml
EUR 338.55
Description: Anti-Bovine HMGB1 Antibody

Human CellExp? HMGB1 /HMG1, Mouse Recombinant

EUR 185

Human CellExp? HMGB1 /HMG1, Mouse Recombinant

EUR 490

Rat HMGB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EGTH0016 96Tests
EUR 521

Bovine HMGB1 ELISA Kit

EBH0016 96Tests
EUR 521

Canine HMGB1 ELISA Kit

ECH0016 96Tests
EUR 521

Chicken HMGB1 ELISA Kit

ECKH0016 96Tests
EUR 521

Anserini HMGB1 ELISA Kit

EAH0016 96Tests
EUR 521

Porcine HMGB1 ELISA Kit

EPH0016 96Tests
EUR 521


ERH0016 96Tests
EUR 521

Rabbit HMGB1 ELISA Kit

ERTH0016 96Tests
EUR 521


ESH0016 96Tests
EUR 521


EMH0016 96Tests
EUR 521

Monkey HMGB1 ELISA Kit

EMKH0016 96Tests
EUR 521

HMGB1 (AcK12) Blocking Peptide

  • EUR 300.00
  • EUR 495.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

HMGB1 recombinant monoclonal antibody

A5052 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human HMGB1 for WB, IF,ELISA

Mouse HMGB1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Acetyl-HMGB1 (K12) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Acetyl-HMGB1 (K12). Recognizes Acetyl-HMGB1 (K12) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000